Plasmid_Backbone
Part:BBa_J61003:Design
Designed by: John Anderson Group: Arkin Lab (2006-07-31)
EN-Ptet-rbs-X-[GFP]-SNP "ORF Expresser"
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Illegal EcoRI site found at 2058
Illegal XbaI site found at 2292 - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2058
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NotI site found at 9
Illegal NotI site found at 2064 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2058 - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Illegal suffix found at 2
Illegal EcoRI site found at 2058
Illegal XbaI site found at 2292 - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2058
Illegal XbaI site found at 2292
Illegal SpeI site found at 2
Illegal PstI site found at 16 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI.rc site found at 1097
Design Notes
N/A
Source
PCR KB001/ca1021R on pSB1A2-J01022 (250 bp, EcoRI/XbaI)
sub into pSB1A2-E0040(GFP;DNA-1-5H) (EcoRI/XbaI)
Product is pBca1021-E0040
ca1021R Reverse b0034 XbaI
AGCCATCTAGAATTTCTCCTCTTTCTCTAG
KB001 Forward EcoRI to construct Ptet part-making biobrick plasmid
ttctggaattcgcggccgcaactagagccaggcatc